RegulonDB RegulonDB 10.10: Gene Sequence
fadR gene sequence


Size: 720        A: 171  T: 180  G: 199  C: 170

Fasta

 

>fadR E. coli K12. Version NC_000913.3 GI:556503834
atggtcattaaggcgcaaagcccggcgggtttcgcggaagagtacattattgaaagtatc
tggaataaccgcttccctcccgggactattttgcccgcagaacgtgaactttcagaatta
attggcgtaacgcgtactacgttacgtgaagtgttacagcgtctggcacgagatggctgg
ttgaccattcaacatggcaagccgacgaaggtgaataatttctgggaaacttccggttta
aatatccttgaaacactggcgcgactggatcacgaaagtgtgccgcagcttattgataat
ttgctgtcggtgcgtaccaatatttccactatttttattcgcaccgcgtttcgtcagcat
cccgataaagcgcaggaagtgctggctaccgctaatgaagtggccgatcacgccgatgcc
tttgccgagctggattacaacatattccgcggcctggcgtttgcttccggcaacccgatt
tacggtctgattcttaacgggatgaaagggctgtatacgcgtattggtcgtcactatttc
gccaatccggaagcgcgcagtctggcgctgggcttctaccacaaactgtcggcgttgtgc
agtgaaggcgcgcacgatcaggtgtacgaaacagtgcgtcgctatgggcatgagagtggc
gagatttggcaccggatgcagaaaaatctgccgggtgatttagccattcaggggcgataa
              
                            

Download fasta file
RegulonDB