RegulonDB RegulonDB 10.10: Gene Sequence
fecB gene sequence


Size: 903        A: 199  T: 183  G: 259  C: 262

Fasta

 

>fecB E. coli K12. Version NC_000913.3 GI:556503834
atgttggcatttatccgttttctttttgcaggcctgctgctggtgatcagccacgccttt
gccgccacggttcaggacgaacacggcacgtttacactcgaaaaaacgccacaacggatt
gtggtgctggaactctcgttcgccgatgcgctggccgccgtggacgtcatcccgatcggt
attgccgacgataacgatgcaaaacgcatcctgcccgaagtgcgtgcgcacctgaaaccg
tggcagtccgtcggaacgcgcgcgcagccgagcctggaagccattgccgctctgaaacca
gacctgatcattgccgacagcagtcgccatgcgggggtttacatcgccttgcagcaaatc
gcgccggtactgctgcttaagtcccgcaacgaaacctacgctgaaaatttgcaatctgcg
gctatcatcggcgaaatggtgggtaaaaagcgagagatgcaggcacgtctggaacaacat
aaagagaggatggcgcagtgggccagccagcttcccaaagggacacgcgtggcctttggc
acatcacgcgaacagcaattcaacctgcatactcaggagacctggaccggcagcgtgctg
gcctctctggggctgaacgttcccgctgcgatggcgggtgcgtccatgccgtccatcggc
ctggagcaactgctggcggtcaatcctgcctggctgctggttgcccactatcgcgaagag
agcattgttaaacgctggcaacaagatccgctctggcagatgttaaccgccgcgcagaag
cagcaggttgcttcggtcgacagtaacacctgggcgcggatgcgcggtatttttgctgca
gagcgtattgccgctgacacggtaaaaatcttccaccatcagccgcttaccgttgtgaaa
tga
              
                            

Download fasta file
RegulonDB