RegulonDB RegulonDB 10.10: Gene Sequence
fecC gene sequence


Size: 999        A: 161  T: 232  G: 304  C: 302

Fasta

 

>fecC E. coli K12. Version NC_000913.3 GI:556503834
atgaccgcgataaaacacccggtgctgctgtgggggcttcccgttgcagcacttattatt
attttctggctgagtctgttttgctactcggccattcctgtttccggagcagatgcaacc
cgcgccctgctgcctggacacacgccaacgctaccagaagcgctggtgcaaaaccttcgt
ttgccacgaagcctggtcgccgttctgatcggcgcaagcctggcgctcgcgggcacgctg
ctgcaaaccctgacccacaacccaatggcctctccttcactgctcggcattaacagcggc
gcggcgctggctatggcgcttaccagcgcgctgagtccgacgccgattgcaggctattct
ctgtcattcatcgcggcatgcgggggcggcgtgagctggctgctggtcatgaccgcagga
ggcggatttcgtcatacccatgacagaaacaaactgatcctcgcgggtatcgcgctgtcg
gccttttgtatgggccttacccgcatcaccctgctgctggccgaagatcatgcttacggc
atcttttactggctggcaggcggagtgtcccacgcccgctggcaggatgtctggcagctc
ttgccggtggtggtcactgcagtccctgtcgtgttgctgctggcgaatcaactgaacctg
ctcaacctcagcgacagcaccgcccatacgctgggagtgaacctgacgaggctacgtttg
gtcatcaatatgttagtgctgcttctggttggtgcgtgcgtcagcgtagcaggtccggtg
gcgtttatcggtctgctggtgccacatctggcgcgcttctgggcaggcttcgatcagcgc
aacgtactgccagtgagcatgctgctgggggccacgctgatgctgctggcagatgtactc
gcacgcgcgctggccttccccggagatctgcccgcaggcgcagtgctggcgctgattggc
agcccttgctttgtctggcttgtgaggaggcgaggatga
              
                            

Download fasta file
RegulonDB