RegulonDB RegulonDB 10.9: Gene Sequence
fecE gene sequence


Size: 768        A: 177  T: 176  G: 210  C: 205

Fasta

 

>fecE E. coli K12. Version NC_000913.3 GI:556503834
atgactttacgaactgaaaatctgacggtcagttacgggacagacaaggtacttaacgac
gtttcactctcactgccaacggggaagatcaccgccctgatcggtcctaacggttgcggg
aaatcgacgctgttaaactgtttttcgcggcttttaatgccgcagtctggcaccgtattt
ctcggcgataatcccataaatatgctctcatcgcgccagttggcccgcaggctttcgctg
ctgcctcagcaccatttaacgccagaggggatcacagtccaggagctggtttcgtatggt
cgtaatccctggctgtcactctgggggcgtctctccgctgaagacaatgcacgagttaat
gtcgccatgaaccagacccggatcaatcatcttgccgttcgtcggttaaccgagctttcc
ggcggtcagcgccagcgcgcatttctggcaatggtcctggcccagaatacgcccgttgta
ttacttgatgagccaaccacctatcttgatatcaatcaccaggtggacctgatgcggttg
atgggcgaactccggactcaggggaaaacggtggtcgctgtgctgcacgaccttaatcag
gctagccggtactgcgatcaactggtggtaatggcaaacggacatgttatggcgcaaggc
acaccagaagaggtgatgaccccaggattgctgagaacagtattcagcgtggaagcggaa
atacaccccgagccggtatctggcaggccgatgtgcctaatgaggtag
              
                            

Download fasta file
RegulonDB