RegulonDB RegulonDB 10.9: Gene Sequence
fecI gene sequence


Size: 522        A: 120  T: 117  G: 140  C: 145

Fasta

 

>fecI E. coli K12. Version NC_000913.3 GI:556503834
atgtctgaccgcgccactaccacagcttccttaacgttcgagtcgctttatggcacacat
cacggctggttgaaaagctggctgacgcgcaaactccagtctgcttttgatgcagatgac
attgcccaggacacttttttgcgggtaatggtcagcgaaacgctctcgacgatccgcgat
cctcgctccttcctctgcactatcgccaaacgcgtgatggtggacctgtttcgccgaaac
gcgctggaaaaagcgtatctggagatgctggcgcttatgccggaggggggagcgccttca
cctgaggaacgcgaaagccaactcgagaccctacaactcctcgacagcatgctggacggg
ctaaacggcaaaacacgtgaagcgtttctgctttcgcaactggatggtctgacatacagc
gagattgcgcacaaactcggtgtttccatcagctccgtgaaaaaatacgtggcgaaagcc
gtcgagcactgcctgctgttccgtctggagtatgggttatga
              
                            

Download fasta file
RegulonDB