RegulonDB RegulonDB 10.10: Gene Sequence
fecR gene sequence


Size: 954        A: 207  T: 184  G: 277  C: 286

Fasta

 

>fecR E. coli K12. Version NC_000913.3 GI:556503834
atgaatcctttgttaaccgattcccgccgtcaggcgctgcgttcagcttcccactggtat
gccgtgctaagcggcgagcgcgtcagcccacaacaggaagcgcgctggcaacagtggtat
gaacaggatcaggataaccagtgggcctggcagcaggttgaaaacctgcgcaaccagctt
ggcggtgtgcctggcgacgttgccagccgggcgttgcacgatacccgcctcacccgccgt
cacgtgatgaaaggattactgctgttgctcggcgctggcggaggctggcagctctggcag
tcggaaaccggcgaaggtctgcgggcagattaccgcaccgccaaaggcacagtcagccgt
cagcaactggaagatggctccctgctcacgctgaatacccaaagcgcggcggatgtgcgt
tttgatgcgcatcagcgcaccgtccggctctggtacggtgaaatcgccattactaccgcg
aaagatgccctgcaacgccccttccgtgtcctgacccgtcagggccagctcactgcttta
gggacagaatttaccgtccgccagcaggataatttcacgcagcttgacgtgcagcagcac
gctgtggaagtgcttctcgccagtgcccccgcgcaaaaacgcatcgtgaacgctggtgaa
agcctgcagttcagcgcctctgagtttggcgcagtgaaaccgctggatgacgagagtaca
agctggacgaaggacatcctgagcttcagcgataaaccgctgggtgaggtgatagccacg
ctaacccgttaccgcaacggcgtgctgcgctgcgatcccgccgttgccgggctgcgcctg
agcgggacgttcccgctgaaaaataccgatgcgatcctgaacgttatcgcgcaaacgctt
cccgttaaaattcagtctattacgcggtactggataaacatttcaccactgtaa
              
                            

Download fasta file
RegulonDB