RegulonDB RegulonDB 10.8: Gene Sequence
fepC gene sequence


Size: 816        A: 200  T: 176  G: 236  C: 204

Fasta

 

>fepC E. coli K12. Version NC_000913.3 GI:556503834
atgaccgaatcagtagcccgtttgcgcggcgaacagttaaccctgggatatggcaaatat
accgttgcggaaaatctgactgtagaaatacctgatggtcacttcacggcaattatcggg
ccaaatggctgcggtaaatccacgttactgcgtaccttaagccgcctgatgacgcctgct
catgggcatgtctggctggatggcgagcacattcaacattacgccagtaaagaggttgca
cgccggattggtctgttggcgcaaaatgctaccacgccgggcgatatcaccgtgcaggag
ctggtggcgcgtggacgttatccgcatcaaccgctgtttacccgctggcgcaaagaggat
gaagaagcggtaacgaaagcaatgcaggccacgggaataactcatctggcagatcaaagc
gtggataccctttctggcggacaacgccagcgagcgtggatcgcgatggtgctggcccag
gaaacggcaattatgctgctcgacgaacccacgacctggctggatatcagtcatcagatt
gatttgctggagttgttaagcgaactgaaccgcgaaaaaggctataccctggcggcggtg
ctgcacgatcttaatcaggcctgtcgttacgccagccatttgattgcattgcgggaaggg
aaaattgttgctcagggagcgccgaaggagattgtcactgctgaactgattgagcgcatt
tatggtctgcgctgcatgatcattgacgatccagttgccggaacgccgcttgtggtgccg
ctcggacgaacggcaccttcaaccgcaaatagttaa
              
                            

Download fasta file
RegulonDB