RegulonDB RegulonDB 10.8: Gene Sequence
ffh gene sequence


Size: 1362        A: 347  T: 277  G: 417  C: 321

Fasta

 

>ffh E. coli K12. Version NC_000913.3 GI:556503834
atgtttgataatttaaccgatcgtttgtcgcgcacgctgcgcaatatcagtggccgtgga
cgcctcactgaagacaacgtaaaagatacgctgcgcgaagtgcgcatggcgctgctggag
gcggacgtagctctgccggtagtgcgtgagtttatcaatcgcgtaaaagagaaagcggtt
ggtcatgaagttaataagagcctgacgccggggcaggagttcgtcaaaatagtccgtaac
gaactggttgcggcgatgggcgaagagaaccagaccctgaacctggctgcgcaaccgcct
gcggtcgtactgatggcgggcctgcaaggtgccggtaaaacaaccagcgttggtaaactc
ggtaagttcctgcgcgagaagcacaagaagaaagtgctggtggtttctgccgacgtttat
cgcccggcggcaatcaaacagcttgagacgctggcagagcaggtgggcgttgatttcttc
ccttctgatgttggtcagaagccggtagatatcgttaacgcggcgctgaaagaagccaaa
ctgaaattctacgacgtgctgctggtggataccgctggtcgtctgcacgttgacgaagcg
atgatggacgagatcaaacaagtccatgcgtcgattaacccggttgaaaccctgtttgtg
gttgacgccatgaccggtcaggatgcggccaatacggcaaaagcattcaatgaagcgtta
ccgcttaccggcgtagtgttgaccaaagtggacggcgatgcccgcggcggtgcggcgctc
tctattcgtcacatcactggcaaaccgatcaagttcctcggtgttggcgagaaaactgag
gcgctggagccgttccatccggaccgcatcgcgtcgcgtattctcggcatgggcgacgta
ctgtcgctgatcgaagatatcgaaagcaaagttgaccgcgcgcaggcagagaaattagcc
agcaagctgaaaaaaggtgacggcttcgatctcaacgactttcttgagcagctgcgccag
atgaaaaatatgggcggcatggctagtctgatgggcaagctgccgggcatggggcagatc
ccggataacgtcaagtcacagatggacgataaagtgctggtgcgtatggaagccatcatc
aactcgatgacgatgaaagagcgcgctaagccagaaatcatcaaaggttcgcgtaaacgc
cgtattgctgccggttgcggtatgcaggtgcaggacgttaaccgtcttctgaaacagttc
gacgacatgcagcgcatgatgaagaaaatgaagaagggcggaatggcgaagatgatgaga
agcatgaagggtatgatgcccccaggcttccctggtcgctaa
              
                            

Download fasta file
RegulonDB