RegulonDB RegulonDB 10.8: Gene Sequence
fimF gene sequence


Size: 531        A: 123  T: 145  G: 132  C: 131

Fasta

 

>fimF E. coli K12. Version NC_000913.3 GI:556503834
atgagaaacaaacctttttatcttctgtgcgcttttttgtggctggcggtgagtcacgct
ttggctgcggatagcacgattactatccgcggctatgtcagggataacggctgtagtgtg
gccgctgaatcaaccaattttactgttgatctgatggaaaacgcggcgaagcaatttaac
aacattggcgcgacgactcctgttgttccatttcgtattttgctgtcaccctgtggtaat
gccgtttctgccgtaaaggttgggtttactggcgttgcagatagccacaatgccaacctg
cttgcacttgaaaatacggtgtcagcggcttcgggactgggaatacagcttctgaatgag
cagcaaaatcaaataccccttaatgctccatcgtccgcgctttcgtggacgaccctgacg
ccgggtaaaccaaatacgctgaatttttacgcccggctaatggcgacacaggtgcctgtc
actgcggggcatatcaatgccacggctaccttcactcttgaatatcagtaa
              
                            

Download fasta file
RegulonDB