RegulonDB RegulonDB 10.8: Gene Sequence
flhC gene sequence


Size: 579        A: 155  T: 140  G: 144  C: 140

Fasta

 

>flhC E. coli K12. Version NC_000913.3 GI:556503834
atgagtgaaaaaagcattgttcaggaagcgcgggatattcagctggcaatggaattgatc
accctgggcgctcgtttgcagatgctggaaagcgaaacacagttaagtcgcggacgcctg
ataaaactttataaagaactgcgcggaagcccaccgccgaaaggcatgctgccattctca
accgactggtttatgacctgggaacaaaacgttcatgcttcgatgttctgtaatgcatgg
cagtttttactgaaaaccggtttgtgtaatggcgtcgatgcggtgatcaaagcctaccgt
ttataccttgaacagtgcccacaagcagaagaaggaccactgctggcattaacccgtgcc
tggacattggtgcggtttgttgaaagtggattactgcaactttccagctgcaactgctgc
ggcggcaattttattacccacgctcaccagcctgttggcagctttgcctgcagcttatgt
caaccgccatcccgggcagtaaaaagacgtaaactttcccagaatcctgccgatattatc
ccacaactgctggatgaacagagagtacaggctgtttaa
              
                            

Download fasta file
RegulonDB