RegulonDB RegulonDB 10.8: Gene Sequence
fliN gene sequence


Size: 414        A: 99  T: 87  G: 130  C: 98

Fasta

 

>fliN E. coli K12. Version NC_000913.3 GI:556503834
atgagtgacatgaataatccggccgatgacaacaacggcgcaatggacgatctgtgggct
gaagcgttgagcgaacaaaaatcaaccagcagcaaaagcgctgccgagacggtgttccag
caatttggcggtggtgatgtcagcggaacgttgcaggatatcgacctgattatggatatt
ccggtcaagctgaccgtcgagctgggccgtacgcggatgaccatcaaagagctgttgcgt
ctgacgcaagggtccgtcgtggcgctggacggtctggcgggcgaaccactggatattctg
atcaacggttatttaatcgcccagggcgaagtggtggtcgttgccgataaatatggcgtg
cggatcaccgatatcattactccgtctgagcgaatgcgccgcctgagccgttag
              
                            

Download fasta file
RegulonDB