RegulonDB RegulonDB 10.8: Gene Sequence
folA gene sequence


Size: 480        A: 120  T: 107  G: 137  C: 116

Fasta

 

>folA E. coli K12. Version NC_000913.3 GI:556503834
atgatcagtctgattgcggcgttagcggtagatcgcgttatcggcatggaaaacgccatg
ccgtggaacctgcctgccgatctcgcctggtttaaacgcaacaccttaaataaacccgtg
attatgggccgccatacctgggaatcaatcggtcgtccgttgccaggacgcaaaaatatt
atcctcagcagtcaaccgggtacggacgatcgcgtaacgtgggtgaagtcggtggatgaa
gccatcgcggcgtgtggtgacgtaccagaaatcatggtgattggcggcggtcgcgtttat
gaacagttcttgccaaaagcgcaaaaactgtatctgacgcatatcgacgcagaagtggaa
ggcgacacccatttcccggattacgagccggatgactgggaatcggtattcagcgaattc
cacgatgctgatgcgcagaactctcacagctattgctttgagattctggagcggcggtaa
              
                            

Download fasta file
RegulonDB