RegulonDB RegulonDB 10.9: Gene Sequence
frdB gene sequence


Size: 735        A: 183  T: 158  G: 195  C: 199

Fasta

 

>frdB E. coli K12. Version NC_000913.3 GI:556503834
atggctgagatgaaaaacctgaaaattgaggtggtgcgctataacccggaagtcgatacc
gcaccgcatagcgcattctatgaagtgccttatgacgcaactacctcattactggatgcg
ctgggctacatcaaagacaacctggcaccggacctgagctaccgctggtcctgccgtatg
gcgatttgtggttcctgcggcatgatggttaacaacgtgccaaaactggcatgtaaaacc
ttcctgcgtgattacaccgacggtatgaaggttgaagcgttagctaacttcccgattgaa
cgcgatctggtggtcgatatgacccacttcatcgaaagtctggaagcgatcaaaccgtac
atcatcggcaactcccgcaccgcggatcagggtactaacatccagaccccggcgcagatg
gcgaagtatcaccagttctccggttgcatcaactgtggtttgtgctacgccgcgtgcccg
cagtttggcctgaacccagagttcatcggtccggctgccattacgctggcgcatcgttat
aacgaagatagccgcgaccacggtaagaaggagcgtatggcgcagttgaacagccagaac
ggcgtatggagctgtactttcgtgggctactgctccgaagtctgcccgaaacacgtcgat
ccggctgcggccattcagcagggcaaagtagaaagttcgaaagactttcttatcgcgacc
ctgaaaccacgctaa
              
                            

Download fasta file
RegulonDB