RegulonDB RegulonDB 10.9: Gene Sequence
frdC gene sequence


Size: 396        A: 100  T: 101  G: 100  C: 95

Fasta

 

>frdC E. coli K12. Version NC_000913.3 GI:556503834
atgacgactaaacgtaaaccgtatgtacggccaatgacgtccacctggtggaaaaaattg
ccgttttatcgcttttacatgctgcgcgaaggcacggcggttccggctgtgtggttcagc
attgaactgattttcgggctgtttgccctgaaaaatggcccggaagcctgggcgggattc
gtcgactttttacaaaacccggttatcgtgatcattaacctgatcactctggcggcagct
ctgctgcacaccaaaacctggtttgaactggcaccgaaagcggccaatatcattgtaaaa
gacgaaaaaatgggaccagagccaattatcaaaagtctctgggcggtaactgtggttgcc
accatcgtaatcctgtttgttgccctgtactggtaa
              
                            

Download fasta file
RegulonDB