RegulonDB RegulonDB 10.9: Gene Sequence
cra gene sequence


Size: 1005        A: 219  T: 234  G: 283  C: 269

Fasta

 

>cra E. coli K12. Version NC_000913.3 GI:556503834
gtgaaactggatgaaatcgctcggctggcgggagtgtcgcggaccactgcaagctatgtt
attaacggcaaagcgaagcaataccgtgtgagcgacaaaaccgttgaaaaagtcatggct
gtggtgcgtgagcacaattaccacccgaacgccgtggcagctgggcttcgtgctggacgc
acacgttctattggtcttgtgatccccgatctggagaacaccagctatacccgcatcgct
aactatcttgaacgccaggcgcggcaacggggttatcaactgctgattgcctgctcagaa
gatcagccagacaacgaaatgcggtgcattgagcaccttttacagcgtcaggttgatgcc
attattgtttcgacgtcgttgcctcctgagcatcctttttatcaacgctgggctaacgac
ccgttcccgattgtcgcgctggaccgcgccctcgatcgtgaacacttcaccagcgtggtt
ggtgccgatcaggatgatgccgaaatgctggcggaagagttacgtaagtttcccgccgag
acggtgctttatcttggtgcgctaccggagctttctgtcagcttcctgcgtgaacaaggt
ttccgtactgcctggaaagatgatccgcgcgaagtgcatttcctgtatgccaacagctat
gagcgggaggcggctgcccagttattcgaaaaatggctggaaacgcatccgatgccgcag
gcgctgttcacaacgtcgtttgcgttgttgcaaggagtgatggatgtcacgctgcgtcgc
gacggcaaactgccttctgacctggcaattgccacctttggcgataacgaactgctcgac
ttcttacagtgtccggtgctggcagtggctcaacgtcaccgcgatgtcgcagagcgtgtg
ctggagattgtcctggcaagcctggacgaaccgcgtaagccaaaacctggtttaacgcgc
attaaacgtaatctctatcgccgcggcgtgctcagccgtagctaa
              
                            

Download fasta file
RegulonDB