RegulonDB RegulonDB 10.7: Gene Sequence
fucK gene sequence


Size: 1419        A: 350  T: 344  G: 380  C: 345

Fasta

 

>fucK E. coli K12. Version NC_000913.3 GI:556503834
atgaaacaagaagttatcctggtactcgactgtggcgcgaccaatgtcagggccatcgcg
gttaatcggcagggcaaaattgttgcccgcgcctcaacgcctaatgccagcgatatcgcg
atggaaaacaacacctggcaccagtggtctttagacgccattttgcaacgctttgctgat
tgctgtcggcaaatcaatagtgaactgactgaatgccacatccgcggtatcgccgtcacc
acctttggtgtggatggcgctctggtagataagcaaggcaatctgctctatccgattatt
agctggaaatgtccgcgaacagcagcggttatggacaatattgaacggttaatctccgca
cagcggttgcaggctatttctggcgtcggagcctttagtttcaatacgttatataagttg
gtgtggttgaaagaaaatcatccacaactgctggaacgcgcgcacgcctggctctttatt
tcgtcgctgattaaccaccgtttaaccggcgaattcactactgatatcacgatggccgga
accagccagatgctggatatccagcaacgcgatttcagtccgcaaattttacaagccacc
ggtattccacgccgactcttccctcgtctggtggaagcgggtgaacagattggtacgcta
cagaacagcgccgcagcaatgctcggcttacccgttggcataccggtgatttccgcaggt
cacgatacccagttcgccctttttggcgctggtgctgaacaaaatgaacccgtgctctct
tccggtacatgggaaattttaatggttcgcagcgcccaggttgatacttcgctgttaagt
cagtacgccggttccacctgcgaactggatagccaggcagggttgtataacccaggtatg
caatggctggcatccggcgtgctggaatgggtgagaaaactgttctggacggctgaaaca
ccctggcaaatgttgattgaagaagctcgtctgatcgcgcctggcgcggatggcgtaaaa
atgcagtgtgatttattgtcgtgtcagaacgctggctggcaaggagtgacgcttaatacc
acgcgggggcatttctatcgcgcggcgctggaagggttaactgcgcaattacagcgcaat
ctacagatgctggaaaaaatcgggcactttaaggcctctgaattattgttagtcggtgga
ggaagtcgcaacacattgtggaatcagattaaagccaatatgcttgatattccggtaaaa
gttctcgacgacgccgaaacgaccgtcgcaggagctgcgctgttcggttggtatggcgta
ggggaatttaacagcccggaagaagcccgcgcacagattcattatcagtaccgttatttc
tacccgcaaactgaacctgaatttatagaggaagtgtga
              
                            

Download fasta file
RegulonDB