RegulonDB RegulonDB 10.9: Gene Sequence
fumA gene sequence


Size: 1647        A: 434  T: 364  G: 452  C: 397

Fasta

 

>fumA E. coli K12. Version NC_000913.3 GI:556503834
atgtcaaacaaaccctttcattatcaggctccttttccactcaaaaaagatgatactgag
tattacctgctaaccagcgaacacgttagcgtatctgaatttgaagggcaggagattttg
aaagtcgcacccgaagcgttaactctgttggcgcgccaggcgtttcatgatgcgtcgttc
atgctgcgtccggcgcaccaacaacaggtggccgacattctgcgtgacccggaggccagc
gaaaatgataaatatgtggcgctgcaattcctgcgtaactccgacatcgcggcgaaaggc
gttctgccaacctgtcaggataccggcaccgcgattattgttggtaaaaaagggcagcgt
gtatggaccggtggtggtgatgaagcggcgctggcgcgcggtgtctataacacttatatc
gaagataatctgcgctactcgcaaaacgcgccgctggatatgtataaagaagtgaatacc
ggcaccaatctgccagcgcagatcgatctttatgccgttgatggcgacgaatacaaattc
ctctgtatcgccaaaggtggtggttcggcaaacaagacgtatctctatcaggaaaccaaa
gcgttactgacgccggggaaactgaaaaattacctggttgagaagatgcgcacgctgggt
acggcggcctgtcctccgtatcatattgcgttcgttattggtggaacttctgcagaaacg
aaccttaaaacggtgaaactggcttccgcgaaatactatgatgaactgccaacggaaggg
aatgagcacggtcaggcgttccgcgatgtggaactggaaaaagaattgctgatcgaagcg
caaaatcttggtctgggtgcgcagtttggtggtaaatacttcgctcacgacatccgcgtg
attcgcctgccacgtcacggcgcatcctgcccggtcggtatgggcgtctcctgctctgct
gaccgtaatatcaaagcgaagatcaaccgtcaggggatctggatcgaaaaactggaacat
aatccaggcaaatatatcccggaagagctgcgcaaagcgggagaaggcgaagcggtgcgc
gttgaccttaaccgtccgatgaaagagatcctcgcacagttgtcgcagtatcccgtttct
acacgcttatcgcttaacggcacgattatcgtcggtcgtgatattgctcacgccaaactg
aaagagcggatggataacggtgaagggctgccgcagtacatcaaagatcatccgatttac
tacgcgggtccggccaaaacgccggaaggttatgcctccggttctcttggcccaacgacc
gccggacggatggattcttatgtcgatcaactgcaagcgcagggcggaagtatgatcatg
ctggcgaaaggcaaccgcagccagcaggtgacggatgcctgtaaaaaacacggcggcttc
taccttggcagtatcggtggtccggccgctgtattggcgcagggaagtattaagagcctg
gaatgtgttgaatatccggaactgggaatggaagccatctggaaaattgaagtggaagat
ttcccggcgtttatccttgtggatgataaaggaaatgacttcttccagcagatacaactc
acacaatgcacccgctgtgtgaaataa
              
                            

Download fasta file
RegulonDB