RegulonDB RegulonDB 10.8: Gene Sequence
gabT gene sequence


Size: 1281        A: 266  T: 255  G: 413  C: 347

Fasta

 

>gabT E. coli K12. Version NC_000913.3 GI:556503834
atgaacagcaataaagagttaatgcagcgccgcagtcaggcgattccccgtggcgttggg
caaattcacccgattttcgctgaccgcgcggaaaactgccgggtgtgggacgttgaaggc
cgtgagtatcttgatttcgcgggcgggattgcggtgctcaataccgggcacctgcatccg
aaggtggtggccgcggtggaagcgcagttgaaaaaactgtcgcacacctgcttccaggtg
ctggcttacgagccgtatctggagctgtgcgagattatgaatcagaaggtgccgggcgat
ttcgccaagaaaacgctgctggttacgaccggttccgaagcggtggaaaacgcggtaaaa
atcgcccgcgccgccaccaaacgtagcggcaccatcgcttttagcggcgcgtatcacggg
cgcacgcattacacgctggcgctgaccggcaaggtgaatccgtactctgcgggcatgggg
ctgatgccgggtcatgtttatcgcgcgctttatccttgcccgctgcacggcataagcgag
gatgacgctatcgccagcatccaccggatcttcaaaaatgatgccgcgccggaagatatc
gccgccatcgtgattgagccggttcagggcgaaggcggtttctacgcctcgtcgccagcc
tttatgcagcgtttacgcgctctgtgtgacgagcacgggatcatgctgattgccgatgaa
gtgcagagcggcgcggggcgtaccggcacgctgtttgcgatggagcagatgggcgttgcg
ccggatcttaccacctttgcgaaatcgatcgcgggcggcttcccgctggcgggcgtcacc
gggcgcgcggaagtaatggatgccgtcgctccaggcggtctgggcggcacctatgcgggt
aacccgattgcctgcgtggctgcgctggaagtgttgaaggtgtttgagcaggaaaatctg
ctgcaaaaagccaacgatctggggcagaagttgaaagacggattgctggcgatagccgaa
aaacacccggagatcggcgacgtacgcgggctgggggcgatgatcgccattgagctgttt
gaagacggcgatcacaacaagccggacgccaaactcaccgccgagatcgtggctcgcgcc
cgcgataaaggcctgattcttctctcctgcggcccgtattacaacgtgctgcgcatcctt
gtaccgctcaccattgaagacgctcagatccgtcagggtctggagatcatcagccagtgt
tttgatgaggcgaagcagtag
              
                            

Download fasta file
RegulonDB