RegulonDB RegulonDB 10.8: Gene Sequence
galT gene sequence


Size: 1047        A: 249  T: 214  G: 281  C: 303

Fasta

 

>galT E. coli K12. Version NC_000913.3 GI:556503834
atgacgcaatttaatcccgttgatcatccacatcgccgctacaacccgctcaccgggcaa
tggattctggtttcaccgcaccgcgctaagcgcccctggcagggggcgcaggaaacgcca
gccaaacaggtgttacctgcgcacgatccagattgcttcctctgcgcaggtaatgtgcgg
gtgacaggcgataaaaaccccgattacaccgggacttacgttttcactaatgactttgcg
gctttgatgtctgacacgccagatgcgccagaaagtcacgatccgctgatgcgttgccag
agcgcgcgcggcaccagccgggtgatctgcttttcaccggatcacagtaaaacgctgcca
gagctcagcgttgcagcattgacggaaatcgtcaaaacctggcaggagcaaaccgcagaa
ctggggaaaacgtacccatgggtgcaggtttttgaaaacaaaggcgcggcgatgggctgc
tctaacccgcatccgcacggtcagatttgggcaaatagcttcctgcctaacgaagctgag
cgcgaagaccgcctgcaaaaagaatattttgccgaacagaaatcaccaatgctggtggat
tatgttcagcgcgagctggcagacggtagccgtaccgttgtcgaaaccgaacactggtta
gccgtcgtgccttactgggctgcctggccgttcgaaacgctactgctgcccaaagcccac
gttttacggatcaccgatttgaccgacgcccagcgcagcgatctggcgctggcgttgaaa
aagctgaccagtcgttatgacaacctcttccagtgctccttcccctactctatgggctgg
cacggcgcgccatttaatggcgaagagaatcaacactggcagctgcacgcgcacttttat
ccgcctctgctgcgctccgccaccgtacgtaaatttatggttggttatgaaatgctggca
gagacccagcgagacctgaccgcagaacaggcagcagagcgtttgcgcgcagtcagcgat
atccattttcgcgaatccggagtgtaa
              
                            

Download fasta file
RegulonDB