RegulonDB RegulonDB 10.9: Gene Sequence
gapA gene sequence


Size: 996        A: 259  T: 239  G: 239  C: 259

Fasta

 

>gapA E. coli K12. Version NC_000913.3 GI:556503834
atgactatcaaagtaggtatcaacggttttggccgtatcggtcgcattgttttccgtgct
gctcagaaacgttctgacatcgagatcgttgcaatcaacgacctgttagacgctgattac
atggcatacatgctgaaatatgactccactcacggccgtttcgacggtaccgttgaagtg
aaagacggtcatctgatcgttaacggtaaaaaaatccgtgttaccgctgaacgtgatccg
gctaacctgaaatgggacgaagttggtgttgacgttgtcgctgaagcaactggtctgttc
ctgactgacgaaactgctcgtaaacacatcaccgctggtgcgaagaaagtggttatgact
ggtccgtctaaagacaacactccgatgttcgttaaaggcgctaacttcgacaaatatgct
ggccaggacatcgtttccaacgcttcctgcaccaccaactgcctggctccgctggctaaa
gttatcaacgataacttcggcatcatcgaaggtctgatgaccaccgttcacgctactacc
gctactcagaaaaccgttgatggcccgtctcacaaagactggcgcggcggccgcggcgct
tcccagaacatcatcccgtcctctaccggtgctgctaaagctgtaggtaaagtactgcca
gaactgaatggcaaactgactggtatggcgttccgcgttccgaccccgaacgtatctgta
gttgacctgaccgttcgtctggaaaaagctgcaacttacgagcagatcaaagctgccgtt
aaagctgctgctgaaggcgaaatgaaaggcgttctgggctacaccgaagatgacgtagta
tctaccgatttcaacggcgaagtttgcacttccgtgttcgatgctaaagctggtatcgct
ctgaacgacaacttcgtgaaactggtatcctggtacgacaacgaaaccggttactccaac
aaagttctggacctgatcgctcacatctccaaataa
              
                            

Download fasta file
RegulonDB