RegulonDB RegulonDB 10.8: Gene Sequence
ispG gene sequence


Size: 1119        A: 272  T: 251  G: 317  C: 279

Fasta

 

>ispG E. coli K12. Version NC_000913.3 GI:556503834
atgcataaccaggctccaattcaacgtagaaaatcaacacgtatttacgttgggaatgtg
ccgattggcgatggtgctcccatcgccgtacagtccatgaccaatacgcgtacgacagac
gtcgaagcaacggtcaatcaaatcaaggcgctggaacgcgttggcgctgatatcgtccgt
gtatccgtaccgacgatggacgcggcagaagcgttcaaactcatcaaacagcaggttaac
gtgccgctggtggctgacatccacttcgactatcgcattgcgctgaaagtagcggaatac
ggcgtcgattgtctgcgtattaaccctggcaatatcggtaatgaagagcgtattcgcatg
gtggttgactgtgcgcgcgataaaaacattccgatccgtattggcgttaacgccggatcg
ctggaaaaagatctgcaagaaaagtatggcgaaccgacgccgcaggcgttgctggaatct
gccatgcgtcatgttgatcatctcgatcgcctgaacttcgatcagttcaaagtcagcgtg
aaagcgtctgacgtcttcctcgctgttgagtcttatcgtttgctggcaaaacagatcgat
cagccgttgcatctggggatcaccgaagccggtggtgcgcgcagcggggcagtaaaatcc
gccattggtttaggtctgctgctgtctgaaggcatcggcgacacgctgcgcgtatcgctg
gcggccgatccggtcgaagagatcaaagtcggtttcgatattttgaaatcgctgcgtatc
cgttcgcgagggatcaacttcatcgcctgcccgacctgttcgcgtcaggaatttgatgtt
atcggtacggttaacgcgctggagcaacgcctggaagatatcatcactccgatggacgtt
tcgattatcggctgcgtggtgaatggcccaggtgaggcgctggtttctacactcggcgtc
accggcggcaacaagaaaagcggcctctatgaagatggcgtgcgcaaagaccgtctggac
aacaacgatatgatcgaccagctggaagcacgcattcgtgcgaaagccagtcagctggac
gaagcgcgtcgaattgacgttcagcaggttgaaaaataa
              
                            

Download fasta file
RegulonDB