RegulonDB RegulonDB 10.9: Gene Sequence
glmS gene sequence


Size: 1830        A: 419  T: 431  G: 508  C: 472

Fasta

 

>glmS E. coli K12. Version NC_000913.3 GI:556503834
atgtgtggaattgttggcgcgatcgcgcaacgtgatgtagcagaaatccttcttgaaggt
ttacgtcgtctggaataccgcggatatgactctgccggtctggccgttgttgatgcagaa
ggtcatatgacccgcctgcgtcgcctcggtaaagtccagatgctggcacaggcagcggaa
gaacatcctctgcatggcggcactggtattgctcacactcgctgggcgacccacggtgaa
ccttcagaagtgaatgcgcatccgcatgtttctgaacacattgtggtggtgcataacggc
atcatcgaaaaccatgaaccgctgcgtgaagagctaaaagcgcgtggctataccttcgtt
tctgaaaccgacaccgaagtgattgcccatctggtgaactgggagctgaaacaaggcggg
actctgcgtgaggccgttctgcgtgctatcccgcagctgcgtggtgcgtacggtacagtg
atcatggactcccgtcacccggataccctgctggcggcacgttctggtagtccgctggtg
attggcctggggatgggcgaaaactttatcgcttctgaccagctggcgctgttgccggtg
acccgtcgctttatcttccttgaagagggcgatattgcggaaatcactcgccgttcggta
aacatcttcgataaaactggcgcggaagtaaaacgtcaggatatcgaatccaatctgcaa
tatgacgcgggcgataaaggcatttaccgtcactacatgcagaaagagatctacgaacag
ccgaacgcgatcaaaaacacccttaccggacgcatcagccacggtcaggttgatttaagc
gagctgggaccgaacgccgacgaactgctgtcgaaggttgagcatattcagatcctcgcc
tgtggtacttcttataactccggtatggtttcccgctactggtttgaatcgctagcaggt
attccgtgcgacgtcgaaatcgcctctgaattccgctatcgcaaatctgccgtgcgtcgt
aacagcctgatgatcaccttgtcacagtctggcgaaaccgcggataccctggctggcctg
cgtctgtcgaaagagctgggttaccttggttcactggcaatctgtaacgttccgggttct
tctctggtgcgcgaatccgatctggcgctaatgaccaacgcgggtacagaaatcggcgtg
gcatccactaaagcattcaccactcagttaactgtgctgttgatgctggtggcgaagctg
tctcgcctgaaaggtctggatgcctccattgaacatgacatcgtgcatggtctgcaggcg
ctgccgagccgtattgagcagatgctgtctcaggacaaacgcattgaagcgctggcagaa
gatttctctgacaaacatcacgcgctgttcctgggccgtggcgatcagtacccaatcgcg
ctggaaggcgcattgaagttgaaagagatctcttacattcacgctgaagcctacgctgct
ggcgaactgaaacacggtccgctggcgctaattgatgccgatatgccggttattgttgtt
gcaccgaacaacgaattgctggaaaaactgaaatccaacattgaagaagttcgcgcgcgt
ggcggtcagttgtatgtcttcgccgatcaggatgcgggttttgtaagtagcgataacatg
cacatcatcgagatgccgcatgtggaagaggtgattgcaccgatcttctacaccgttccg
ctgcagctgctggcttaccatgtcgcgctgatcaaaggcaccgacgttgaccagccgcgt
aacctggcaaaatcggttacggttgagtaa
              
                            

Download fasta file
RegulonDB