RegulonDB RegulonDB 10.10: Gene Sequence
glpA gene sequence


Size: 1629        A: 348  T: 347  G: 473  C: 461

Fasta

 

>glpA E. coli K12. Version NC_000913.3 GI:556503834
atgaaaactcgcgactcgcaatcaagtgacgtgattatcattggcggcggcgcaacggga
gccgggattgcccgcgactgtgccctgcgcgggctgcgcgtgattttggttgagcgccac
gacatcgcaaccggtgccaccgggcgtaaccacggcctgctgcacagcggtgcgcgctat
gcggtaaccgatgcggaatcggcccgcgaatgcattagtgaaaaccagatcctgaaacgc
attgcacgtcactgcgttgaaccaaccaacggcctgtttatcaccctgccggaagatgac
ctctccttccaggccacttttattcgcgcctgcgaagaagcagggatcagcgcagaagct
atagacccgcagcaagcgcgcattatcgaacctgccgttaacccggcactgattggcgcg
gtgaaagttccggatggcaccgttgatccatttcgtctgaccgcagcaaacatgctggat
gccaaagaacacggtgccgttatccttaccgctcatgaagtcacggggctgattcgtgaa
ggcgcgacggtgtgcggtgttcgtgtacgtaaccatctcaccggcgaaactcaggccctt
catgcacctgtcgtggttaatgccgctgggatctgggggcaacacattgccgaatatgcc
gatctgcgcattcgcatgttcccggcgaaaggatcgctgctgatcatggatcaccgcatt
aaccagcatgtgatcaaccgctgccgtaaaccttccgacgccgatattctggtgcctggc
gataccatttcgctgattggtaccacctctttacgtattgattacaacgagattgacgat
aatcgagtgacggcagaagaggttgatattctgctgcgtgaaggggaaaaactggccccc
gtgatggcgaaaacgcgcattttgcgggcctattctggcgtgcgcccgctggttgccagc
gatgacgacccgagcggacgtaacgtcagccgtggcatcgtgctgctcgaccatgctgaa
cgcgatggtctggacggatttatcaccatcaccggtggcaaactgatgacctatcggctg
atggctgaatgggctaccgacgcggtatgccgcaaactgggcaacacgcgcccctgtacg
actgccgatctggcactgcctggttcacaagaacccgctgaagttaccttgcgtaaagtc
atctccctgcctgccccgctgcgcggttctgcggtttatcgtcatggcgatcgcacgcct
gcctggctgagcgaaggccgtctgcaccgtagcctggtatgtgagtgcgaagcggtaact
gcgggtgaagtgcagtacgcggtagaaaatttaaacgttaatagcctgctggatttacgc
cgtcgtacccgtgtggggatgggcacctgccagggcgaactctgcgcctgccgcgctgcc
ggactgctgcaacgttttaacgtcacgacgtccgcgcaatctatcgagcaactttccacc
ttccttaacgaacgctggaaaggcgtgcaacccatcgcctggggagatgcactgcgcgaa
agcgaatttacccgctgggtttatcagggattgtgtggtctggagaaggagcagaaagat
gcgctttga
              
                            

Download fasta file
RegulonDB