RegulonDB RegulonDB 10.10: Gene Sequence
glpB gene sequence


Size: 1260        A: 263  T: 293  G: 356  C: 348

Fasta

 

>glpB E. coli K12. Version NC_000913.3 GI:556503834
atgcgctttgatactgtcattatgggcggcggcctcgccggattactctgtggcctgcaa
ctgcaaaaacacggcctgcgctgtgccattgtcactcgtggtcaaagcgcactgcatttc
tcatccggatcgctggatttgctgagccatctgccagatggtcaaccggtgacagacatt
cacagtggactggaatctttgcgtcagcaggcaccagcccatccttactcccttctcgag
ccacaacgcgtgctcgatctcgcttgccaggcgcaggcattaatcgctgaaagcggtgcg
caattgcagggcagcgtagaacttgctcaccagcgggttacgccgctcggcactctgcgc
tctacctggctaagttcgccagaagtccccgtctggccgctgcccgcgaagaaaatatgt
gtagtgggaattagcggcctgatggattttcaggcgcaccttgcggcagcttcgttgcgt
gaactcggccttgccgttgaaaccgcagaaatagagctgccggaactggatgtgctgcgc
aataacgccaccgaatttcgcgcggtgaatatcgcccgtttccttgataatgaagaaaac
tggccgctgttacttgatgcgcttattcctgtcgccaatacctgcgaaatgatcctgatg
cccgcctgcttcggtctggccgatgacaaactgtggcgttggttgaatgaaaaactacct
tgttcactgatgcttttgccaacgctgccgccttccgtgctgggcattcgtctgcaaaac
cagttacagcgccagtttgtgcgccagggtggcgtgtggatgccgggcgatgaagtgaaa
aaagtgacctgtaaaaatggcgtagtgaacgaaatctggacccgcaatcacgccgatatt
ccgctacgtccacgtttcgcggttctcgccagcggcagtttctttagtggcggactggta
gcggaacgtaacggcattcgagagccgattctcggccttgatgtgctacaaaccgccacg
cggggtgaatggtataagggagatttttttgcgccgcaaccgtggcagcagttcggtgta
accactgatgagacgctacgcccgtcacaggcagggcaaaccattgaaaacctgtttgcc
atcggttcggtgctgggcggatttgatcccatcgcccagggatgcggcggcggtgtttgt
gccgtcagtgctttacatgccgctcaacagattgcccaacgcgcaggaggccaacaatga
              
                            

Download fasta file
RegulonDB