RegulonDB RegulonDB 10.10: Gene Sequence
glpC gene sequence


Size: 1191        A: 299  T: 249  G: 314  C: 329

Fasta

 

>glpC E. coli K12. Version NC_000913.3 GI:556503834
atgaatgacaccagcttcgaaaactgcattaagtgcaccgtctgcaccaccgcctgcccg
gtgagccgggtgaatcccggttatccagggccaaaacaagccgggccggatggcgagcgt
ctgcgtttgaaagatggcgcactgtatgacgaggcgctgaaatattgcatcaactgcaaa
cgttgtgaagtcgcctgcccgtccgatgtgaagattggcgatattatccagcgcgcgcgg
gcgaaatatgacaccacgcgcccgtcgctgcgtaattttgtgttgagtcataccgacctg
atgggtagcgtttccacgccgttcgcaccaatcgtcaacaccgctacctcgctgaaaccg
gtgcggcagctgcttgatgcggcgttaaaaatcgatcatcgccgcacgctaccgaaatac
tccttcggcacgttccgtcgctggtatcgcagcgtggcggctcagcaagcacaatataaa
gaccaggtcgctttctttcacggctgcttcgttaactacaaccatccgcagttaggtaaa
gatttaattaaagtgctcaacgcaatgggtaccggtgtacaactgctcagcaaagaaaaa
tgctgcggcgtaccgctaatcgccaacggctttaccgataaagcacgcaaacaggcaatt
acgaatgtagagtcgatccgcgaagctgtgggagtaaaaggcattccggtgattgccacc
tcctcaacctgtacatttgccctgcgcgacgaatacccggaagtgctgaatgtcgacaac
aaaggcttgcgcgatcatatcgaactggcaacccgctggctgtggcgcaagctggacgaa
ggcaaaacgttaccgctgaaaccgctgccgctgaaagtggtttatcacactccgtgccat
atggaaaaaatgggctggacgctctacaccctggagctgttgcgtaacatcccggggctt
gagttaacggtgctggattcccagtgctgcggtattgcgggtacttacggtttcaaaaaa
gagaactaccccacctcacaagccatcggcgcaccactgttccgccagatagaagaaagc
ggcgcagatctggtggtcaccgactgcgaaacctgtaaatggcagattgagatgtccaca
agtcttcgctgcgaacatccgattacgctactggcccaggcgctggcttaa
              
                            

Download fasta file
RegulonDB