RegulonDB RegulonDB 10.10: Gene Sequence
glpD gene sequence


Size: 1506        A: 343  T: 334  G: 440  C: 389

Fasta

 

>glpD E. coli K12. Version NC_000913.3 GI:556503834
atggaaaccaaagatctgattgtgatagggggcggcatcaatggtgctggtatcgcggca
gacgccgctggacgcggtttatccgtgctgatgctggaggcgcaggatctcgcttgcgcg
acctcttccgccagttcaaaactcattcacggtggcctgcgctaccttgagcactatgaa
ttccgcctggtcagcgaggcgctggctgaacgtgaagtgctgctgaaaatggccccgcat
atcgccttcccgatgcgttttcgcctgccacatcgtccgcatctgcgcccggcgtggatg
attcgcattggtctgtttatgtacgatcatctgggtaaacgcaccagcttgccgggatca
actggtttgcgttttggcgcaaattcagtgttaaaaccggaaattaagcgcggattcgaa
tattctgactgttgggtagacgacgcccgtctggtactcgccaacgcccagatggtggtg
cgtaaaggcggcgaagtgcttactcggactcgcgccacctctgctcgccgcgaaaacggc
ctgtggattgtggaagcggaagatatcgataccggcaaaaaatatagctggcaagcgcgc
ggcttggttaacgccaccggcccgtgggtgaaacagttcttcgacgacgggatgcatctg
ccttcgccttatggcattcgcctgatcaaaggcagccatattgtggtgccgcgcgtgcat
acccagaagcaagcctacattctgcaaaacgaagataaacgtattgtgttcgtgatcccg
tggatggacgagttttccatcatcggcactaccgatgtcgagtacaaaggcgatccgaaa
gcggtgaagattgaagagagtgaaatcaattacctgctgaatgtgtataacacgcacttt
aaaaagcagttaagccgtgacgatatcgtctggacctactccggtgtgcgtccgctgtgt
gatgatgagtccgactcgccgcaggctattacccgtgattacacccttgatattcatgat
gaaaatggcaaagcaccgctgctgtcggtattcggcggtaagctgaccacctaccgaaaa
ctggcggaacatgcgctggaaaaactaacgccgtattatcagggtattggcccggcatgg
acgaaagagagtgtgctaccgggtggcgccattgaaggcgaccgcgacgattatgccgct
cgcctgcgccgccgctatccgttcctgactgaatcgctggcgcgtcattacgctcgcact
tacggcagcaacagcgagctgctgctcggcaatgcgggaacggtaagcgatctcggggaa
gatttcggtcatgagttctacgaagcggagctgaaatacctggtggatcacgaatgggtc
cgccgcgccgacgacgccctgtggcgtcgcacaaaacaaggcatgtggctaaatgcggat
caacaatctcgtgtgagtcagtggctggtggagtatacgcagcagaggttatcgctggcg
tcgtaa
              
                            

Download fasta file
RegulonDB