RegulonDB RegulonDB 10.10: Gene Sequence
glpF gene sequence


Size: 846        A: 157  T: 258  G: 226  C: 205

Fasta

 

>glpF E. coli K12. Version NC_000913.3 GI:556503834
atgagtcaaacatcaaccttgaaaggccagtgcattgctgaattcctcggtaccgggttg
ttgattttcttcggtgtgggttgcgttgcagcactaaaagtcgctggtgcgtcttttggt
cagtgggaaatcagtgtcatttggggactgggggtggcaatggccatctacctgaccgca
ggggtttccggcgcgcatcttaatcccgctgttaccattgcattgtggctgtttgcctgt
ttcgacaagcgcaaagttattccttttatcgtttcacaagttgccggcgctttctgtgct
gcggctttagtttacgggctttactacaatttatttttcgacttcgagcagactcatcac
attgttcgcggcagcgttgaaagtgttgatctggctggcactttctctacttaccctaat
cctcatatcaattttgtgcaggctttcgcagttgagatggtgattaccgctattctgatg
gggctgatcctggcgttaacggacgatggcaacggtgtaccacgcggccctttggctccc
ttgctgattggtctactgattgcggtcattggcgcatctatgggcccattgacaggtttt
gccatgaacccagcgcgtgacttcggtccgaaagtctttgcctggctggcgggctggggc
aatgtcgcctttaccggcggcagagacattccttacttcctggtgccgcttttcggccct
atcgttggcgcgattgtaggtgcatttgcctaccgcaaactgattggtcgccatttgcct
tgcgatatctgtgttgtggaagaaaaggaaaccacaactccttcagaacaaaaagcttcg
ctgtaa
              
                            

Download fasta file
RegulonDB