RegulonDB RegulonDB 10.9: Gene Sequence
glpK gene sequence


Size: 1509        A: 368  T: 325  G: 436  C: 380

Fasta

 

>glpK E. coli K12. Version NC_000913.3 GI:556503834
atgactgaaaaaaaatatatcgttgcgctcgaccagggcaccaccagctcccgcgcggtc
gtaatggatcacgatgccaatatcattagcgtgtcgcagcgcgaatttgagcaaatctac
ccaaaaccaggttgggtagaacacgacccaatggaaatctgggccacccaaagctccacg
ctggtagaagtgctggcgaaagccgatatcagttccgatcaaattgcagctatcggtatt
acgaaccagcgtgaaaccactattgtctgggaaaaagaaaccggcaagcctatctataac
gccattgtctggcagtgccgtcgtaccgcagaaatctgcgagcatttaaaacgtgacggt
ttagaagattatatccgcagcaataccggtctggtgattgacccgtacttttctggcacc
aaagtgaagtggatcctcgaccatgtggaaggctctcgcgagcgtgcacgtcgtggtgaa
ttgctgtttggtacggttgatacgtggcttatctggaaaatgactcagggccgtgtccat
gtgaccgattacaccaacgcctctcgtaccatgttgttcaacatccataccctggactgg
gacgacaaaatgctggaagtgctggatattccgcgcgagatgctgccagaagtgcgtcgt
tcttccgaagtatacggtcagactaacattggcggcaaaggcggcacgcgtattccaatc
tccgggatcgccggtgaccagcaggccgcgctgtttggtcagttgtgcgtgaaagaaggg
atggcgaagaacacctatggcactggctgctttatgctgatgaacactggcgagaaagcg
gtgaaatcagaaaacggcctgctgaccaccatcgcctgcggcccgactggcgaagtgaac
tatgcgttggaaggtgcggtgtttatggcaggcgcatccattcagtggctgcgcgatgaa
atgaagttgattaacgacgcctacgattccgaatatttcgccaccaaagtgcaaaacacc
aatggtgtgtatgtggttccggcatttaccgggctgggtgcgccgtactgggacccgtat
gcgcgcggggcgattttcggtctgactcgtggggtgaacgctaaccacattatacgcgcg
acgctggagtctattgcttatcagacgcgtgacgtgctggaagcgatgcaggccgactct
ggtatccgtctgcacgccctgcgcgtggatggtggcgcagtagcaaacaatttcctgatg
cagttccagtccgatattctcggcacccgcgttgagcgcccggaagtgcgcgaagtcacc
gcattgggtgcggcctatctcgcaggcctggcggttggcttctggcagaacctcgacgag
ctgcaagagaaagcggtgattgagcgcgagttccgtccaggcatcgaaaccactgagcgt
aattaccgttacgcaggctggaaaaaagcggttaaacgcgcgatggcgtgggaagaacac
gacgaataa
              
                            

Download fasta file
RegulonDB