RegulonDB RegulonDB 10.9: Gene Sequence
glpQ gene sequence


Size: 1077        A: 322  T: 264  G: 288  C: 203

Fasta

 

>glpQ E. coli K12. Version NC_000913.3 GI:556503834
atgaaattgacgctgaaaaaccttagcatggcgatcatgatgagcactatagtcatggga
agcagtgcaatggcggcggacagcaacgaaaaaatagtcatcgcccatcgcggtgccagt
ggatatttgccggagcatacgctgccagcaaaagcgatggcgtatgcgcagggagcggat
tatctggaacaggatttggtgatgaccaaagacgacaatctggttgttctgcatgaccat
tacctcgatcgtgttactgatgttgccgatcgtttcccggatcgggcgcgcaaagacggt
cgttactacgcgatagatttcacgctggatgaaattaagtcgttgaaatttaccgaaggt
ttcgatattgaaaacggtaaaaaagtgcagacttatccggggcgtttcccaatgggtaag
tccgacttccgggtgcacacctttgaagaagagattgaatttgttcaggggttaaatcac
tctaccgggaaaaatatcggtatttatccagaaatcaaagcgccgtggttccatcatcag
gaagggaaggatattgcggcaaaaacgctggaagtgctgaagaaatatggttacaccggt
aaagacgataaagtttatttgcaatgttttgatgctgatgagctgaagcgtattaagaat
gagctggaacccaaaatgggcatggagctcaatctggtacagctgattgcctataccgac
tggaatgaaacgcagcagaaacagccggatggaagctgggttaattacaactacgactgg
atgtttaagccgggtgccatgaaacaggtggcggaatatgcagatggtattggtccggat
taccatatgttgattgaggagacatcgcagccgggtaatatcaaactcactggcatggtg
caagatgctcagcagaataaactggtagtgcatccttataccgtgcggtcagataaactg
cctgaatacactcctgatgtgaatcagttatatgatgctctgtataacaaagcgggtgta
aatgggctgtttactgatttccctgataaggcagtaaaatttcttaataaagagtaa
              
                            

Download fasta file
RegulonDB