RegulonDB RegulonDB 10.9: Gene Sequence
glpR gene sequence


Size: 758        A: 187  T: 157  G: 201  C: 213

Fasta

 

>glpR E. coli K12. Version NC_000913.3 GI:556503834
atgaaacaaacacaacgtcacaacggtattatcgaactggttaaacagcagggttatgtc
agtaccgaagagctggtagagcatttctccgtcagcccgcagactattcgccgcgacctc
aatgagctggcggagcaaaacctgatcctggccatcatggcggtgcggcgctgccttcca
gttcggttaacacgccgtggcacgatcgcaaggccacccagaccgaagaaaaagagcgca
tcgcccgcaaagtggcggagcaaatccccaatggctcgacgctgtttatcgatatcggca
ccacgccggaagcggtagcgcacgcactgctcaatcacagcaatttgcgcattgtcacca
acaatctcaacgttgctaacacgttgatggtaaaagaagattttcgcatcattctcgccg
gtggcgaattacgcagccgcgatggcgggatcattggcgaagcgacgctcgattttatct
cccagttccgccttgatttcggcattctggggataagcggcatcgatagcgacggctcgc
tgctggagttcgattaccacgaagttcgcaccaaacgcgccattattgagaactcgcgcc
acgttatgctggttgtcgatcactcgaaatttggccgtaacgcgatggtcaatatgggca
gcatcagcatggtagatgccgtctacaccgacgccccgccgccagtaagcgtgatgcagg
tgctgacggaccaccatattcaactggagctgtgctga
              
                            

Download fasta file
RegulonDB