RegulonDB RegulonDB 10.8: Gene Sequence
glyA gene sequence


Size: 1254        A: 311  T: 274  G: 343  C: 326

Fasta

 

>glyA E. coli K12. Version NC_000913.3 GI:556503834
atgttaaagcgtgaaatgaacattgccgattatgatgccgaactgtggcaggctatggag
caggaaaaagtacgtcaggaagagcacatcgaactgatcgcctccgaaaactacaccagc
ccgcgcgtaatgcaggcgcagggttctcagctgaccaacaaatatgctgaaggttatccg
ggcaaacgctactacggcggttgcgagtatgttgatatcgttgaacaactggcgatcgat
cgtgcgaaagaactgttcggcgctgactacgctaacgtccagccgcactccggctcccag
gctaactttgcggtctacaccgcgctgctggaaccaggtgataccgttctgggtatgaac
ctggcgcatggcggtcacctgactcacggttctccggttaacttctccggtaaactgtac
aacatcgttccttacggtatcgatgctaccggtcatatcgactacgccgatctggaaaaa
caagccaaagaacacaagccgaaaatgattatcggtggtttctctgcatattccggcgtg
gtggactgggcgaaaatgcgtgaaatcgctgacagcatcggtgcttacctgttcgttgat
atggcgcacgttgcgggcctggttgctgctggcgtctacccgaacccggttcctcatgct
cacgttgttactaccaccactcacaaaaccctggcgggtccgcgcggcggcctgatcctg
gcgaaaggtggtagcgaagagctgtacaaaaaactgaactctgccgttttccctggtggt
cagggcggtccgttgatgcacgtaatcgccggtaaagcggttgctctgaaagaagcgatg
gagcctgagttcaaaacttaccagcagcaggtcgctaaaaacgctaaagcgatggtagaa
gtgttcctcgagcgcggctacaaagtggtttccggcggcactgataaccacctgttcctg
gttgatctggttgataaaaacctgaccggtaaagaagcagacgccgctctgggccgtgct
aacatcaccgtcaacaaaaacagcgtaccgaacgatccgaagagcccgtttgtgacctcc
ggtattcgtgtaggtactccggcgattacccgtcgcggctttaaagaagccgaagcgaaa
gaactggctggctggatgtgtgacgtgctggacagcatcaatgatgaagccgttatcgag
cgcatcaaaggtaaagttctcgacatctgcgcacgttacccggtttacgcataa
              
                            

Download fasta file
RegulonDB