RegulonDB RegulonDB 10.9: Gene Sequence
ihfB gene sequence


Size: 285        A: 84  T: 61  G: 70  C: 70

Fasta

 

>ihfB E. coli K12. Version NC_000913.3 GI:556503834
atgaccaagtcagaattgatagaaagacttgccacccagcaatcgcacattcccgccaag
acggttgaagatgcagtaaaagagatgctggagcatatggcctcgactcttgcgcagggc
gagcgtattgaaatccgcggtttcggcagtttctctttgcactaccgcgcaccacgtacc
ggacgtaatccgaagactggcgataaagtagaactggaaggaaaatacgttcctcacttt
aaacctggtaaagaactgcgcgatcgcgccaatatttacggttaa
              
                            

Download fasta file
RegulonDB