RegulonDB RegulonDB 10.8: Gene Sequence
hisA gene sequence


Size: 738        A: 158  T: 158  G: 242  C: 180

Fasta

 

>hisA E. coli K12. Version NC_000913.3 GI:556503834
atgattattccggcattagatttaatcgacggcactgtggtgcgtctccatcagggcgat
tacggcaaacagcgcgattacggtaacgacccgctgccgcgattgcaggattacgccgcg
cagggtgccgaagtgctgcacctggtggatctgaccggggcaaaagatccggctaaacgt
caaatcccgctgattaaaaccctggtcgcgggcgttaacgttccggtgcaggttggcggc
ggcgtgcgtagcgaagaagatgtggcggcgttactggaagcgggcgttgcgcgcgtagtg
gtcggctccaccgcggtgaaatcacaagatatggtgaaaggctggtttgaacgcttcggt
gccgatgccttagtgctggcgctggatgtccgtattgacgagcaaggcaacaagcaggtg
gcagtcagcggctggcaagagaactcgggcgtttcactggaacaactggtggaaacctat
ctgcccgtcggcctgaaacatgtgctgtgtaccgatatctcgcgcgacggcacgctggca
ggctctaacgtctctttatatgaagaagtgtgcgccagatatccgcaggtggcatttcag
tcctccggcggtattggcgacattgatgatgtggcggccctgcgtggcactggtgtgcgc
ggcgtaatagttggtcgggcattactggaaggtaaattcaccgtgaaggaggccatcgca
tgctggcaaaacgcataa
              
                            

Download fasta file
RegulonDB