RegulonDB RegulonDB 10.8: Gene Sequence
hisB gene sequence


Size: 1068        A: 263  T: 235  G: 288  C: 282

Fasta

 

>hisB E. coli K12. Version NC_000913.3 GI:556503834
atgagtcagaagtatctttttatcgatcgcgatggaaccctgattagcgaaccgccgagt
gattttcaggtggaccgttttgataaactcgcctttgaaccgggcgtgatcccggaactg
ctgaagctgcaaaaagcgggctacaagctggtgatgatcactaatcaggatggtcttgga
acacaaagtttcccacaggcggatttcgatggcccgcacaacctgatgatgcagatcttc
acctcgcaaggcgtacagtttgatgaagtgctgatttgtccgcacctgcccgccgatgag
tgcgactgccgtaagccgaaagtaaaactggtggaacgttatctggctgagcaagcgatg
gatcgcgctaacagttatgtgattggcgatcgcgcgaccgacattcaactggcggaaaac
atgggcattactggtttacgctacgaccgcgaaaccctgaactggccaatgattggcgag
caactcaccagacgtgaccgttacgctcacgtagtgcgtaataccaaagagacgcagatt
gacgttcaggtgtggctggatcgtgaaggtggcagcaagattaacaccggcgttggcttc
tttgatcatatgctggatcagatcgctacccacggcggtttccgcatggaaatcaacgtc
aaaggcgacctctatatcgacgatcaccacaccgtcgaagataccggcctggcgctgggc
gaagcgctaaaaatcgccctcggagacaaacgcggtatttgccgctttggttttgtgcta
ccgatggacgaatgccttgcccgctgcgcgctggatatctctggtcgcccgcacctggaa
tataaagccgagtttacctaccagcgcgtgggcgatctcagcaccgaaatgatcgagcac
ttcttccgttcgctctcatacaccatgggcgtgacgctacacctgaaaaccaaaggtaaa
aacgatcatcaccgtgtagagagtctgttcaaagcctttggtcgcaccctgcgccaggcc
atccgcgtggaaggcgataccctgccctcgtcgaaaggagtgctgtaa
              
                            

Download fasta file
RegulonDB