RegulonDB RegulonDB 10.8: Gene Sequence
hisF gene sequence


Size: 777        A: 197  T: 177  G: 215  C: 188

Fasta

 

>hisF E. coli K12. Version NC_000913.3 GI:556503834
atgctggcaaaacgcataatcccatgtctcgacgttcgtgatggtcaggtggtgaaaggc
gtacagtttcgcaaccatgaaatcattggcgatatcgtgccgctggcaaaacgctacgct
gaagaaggcgctgacgaactggtgttctacgatatcaccgcttccagcgatggccgtgtg
gtagataaaagctgggtatctcgcgtggcggaagtgatcgacattccgttttgtgtggcg
ggtgggattaagtctctggaagatgccgcgaaaattctttcctttggcgcggataaaatt
tccatcaactctcctgcgctggcagacccaacattaattactcgcctggccgatcgcttt
ggcgtgcagtgtattgtggtcggtattgatacctggtacgacgccgaaaccggtaaatat
catgtgaatcaatataccggcgatgaaagccgcacccgcgtcactcaatgggaaacgctc
gactgggtacaggaagtgcaaaaacgcggtgccggagaaatcgtcctcaatatgatgaat
caggacggcgtgcgtaacggttacgacctcgaacaactgaaaaaagtgcgtgaagtttgc
cacgtcccgctgattgcctccggtggcgcgggcaccatggaacacttcctcgaagccttc
cgcgatgccgacgttgacggcgcgctggcagcttccgtattccacaaacaaataatcaat
attggtgaattaaaagcgtacctggcaacacagggcgtggagatcaggatatgttaa
              
                            

Download fasta file
RegulonDB