RegulonDB RegulonDB 10.8: Gene Sequence
hisI gene sequence


Size: 612        A: 163  T: 115  G: 166  C: 168

Fasta

 

>hisI E. coli K12. Version NC_000913.3 GI:556503834
atgttaacagaacaacaacgtcgcgaactggactgggaaaaaaccgacggacttatgccg
gtgattgtgcaacacgcggtatccggcgaagtgctaatgctgggctatatgaacccggaa
gccttagacaaaaccctcgaaagcggcaaagtcaccttcttctcgcgcactaaacagcga
ctgtggaccaaaggcgaaacgtcgggcaatttcctcaacgtagtgagtattgccccggac
tgcgacaacgacacgttactggtgctggcgaatcccatcggcccgacctgccacaaaggc
accagcagttgcttcggcgacaccgctcaccagtggctgttcctgtatcaactggaacaa
ctgctcgccgagcgcaaatctgccgatccggaaacctcctacaccgccaaactgtatgcc
agcggcaccaaacgcattgcgcagaaagtgggtgaagaaggcgtggaaaccgcgctggca
gcaacggtacatgaccgctttgagctgaccaacgaggcgtctgatttgatgtatcacctg
ctggtgttgttgcaggatcaggggctggatttaacgacggtaattgagaacctgcgtaaa
cggcatcagtga
              
                            

Download fasta file
RegulonDB