RegulonDB RegulonDB 10.8: Gene Sequence
hisS gene sequence


Size: 1275        A: 282  T: 295  G: 385  C: 313

Fasta

 

>hisS E. coli K12. Version NC_000913.3 GI:556503834
gtggcaaaaaacattcaagccattcgcggcatgaacgattacctgcctggcgaaacggcc
atctggcagcgcattgaaggcacactgaaaaacgtgctcggcagctacggttacagtgaa
atccgcttgccgattgtagagcagaccccgctattcaaacgtgcgattggtgaagtcacc
gacgtggttgaaaaagagatgtacacctttgaggatcgcaatggcgacagcctgactctg
cgccctgaagggacggcgggctgtgtacgcgccggcatcgagcatggtcttctgtacaat
caggaacagcgtctgtggtatatcgggccgatgttccgtcacgagcgtccgcagaaaggg
cgttatcgtcagttccatcagttgggctgcgaagttttcggtctgcaaggtccggatatc
gacgctgaactgattatgctcactgcccgctggtggcgcgcgctgggtatttccgagcac
gtaactcttgagctgaactctatcggttcgctggaagcacgcgccaattaccgcgatgcg
ctggtggcattccttgagcagcataaagaaaagctggacgaagactgcaaacgccgcatg
tacactaacccgctgcgcgtgctggattcaaaaaatccggaagtgcaggcgcttctcaac
gacgctccggcattaggtgactatctggacgaggaatctcgtgagcattttgccggtctg
tgcaaactgctggagagcgcggggatcgcttacaccgtaaaccagcgtctggtgcgtggt
ctggattactacaaccgtaccgttttcgagtgggtgactaacagtctcggctcccagggc
accgtgtgtgcaggcggtcgttatgacggtcttgtggaacaactgggcggtcgtgcaaca
ccggctgtcggttttgctatgggcctcgaacgtcttgtattgttagtacaggccgttaat
ccggaatttaaagccgatcctgttgtcgatatatacctggtggcttcaggtgctgataca
caatctgcggctatggcattagctgagcgtctgcgtgatgaattaccgggcgtgaaattg
atgaccaaccacggcggcggcaactttaagaaacagtttgcccgtgctgataaatggggt
gcccgcgttgctgtggtgctgggtgagtctgaagtggctaacggcacagcagtagtgaag
gatttgcgctctggtgagcaaacggcagttgcgcaggatagcgtagccgcgcatttgcgc
acgttactgggttaa
              
                            

Download fasta file
RegulonDB