RegulonDB RegulonDB 10.8: Gene Sequence
hmp gene sequence


Size: 1191        A: 309  T: 257  G: 326  C: 299

Fasta

 

>hmp E. coli K12. Version NC_000913.3 GI:556503834
atgcttgacgctcaaaccatcgctacagtaaaagccaccatccctttactggtggaaacg
gggccaaagttaaccgcccatttctacgaccgtatgtttactcataacccagaactcaaa
gaaatttttaacatgagtaaccagcgtaatggcgatcaacgtgaagccctgtttaacgct
attgccgcctacgccagtaatattgaaaacctgcctgcgctgctgccagcggtagaaaaa
atcgcgcagaagcacaccagcttccagatcaaaccggaacagtacaacatcgtcggtgaa
cacctgttggcaacgctggacgaaatgttcagcccggggcaggaagtgctggacgcgtgg
ggtaaagcctatggtgtactggctaatgtatttatcaatcgcgaggcggaaatctataac
gaaaacgccagcaaagccggtggttgggaaggtactcgcgatttccgcattgtggctaaa
acaccgcgcagcgcgcttatcaccagcttcgaactggagccggtcgacggtggcgcagtg
gcagaataccgtccggggcaatatctcggcgtctggctgaagccggaaggtttcccacat
caggaaattcgtcagtactctttgactcgcaaaccggatggcaaaggctatcgtattgcg
gtgaaacgcgaagagggtgggcaggtatccaactggttgcacaatcacgccaatgttggc
gatgtcgtgaaactggtcgctccggcaggtgatttctttatggctgtcgcagatgacaca
ccagtgacgttaatctctgccggtgttggtcaaacgccaatgctggcaatgctcgacacg
ctggcaaaagcaggccacacagcacaagtgaactggttccatgcggcagaaaatggcgat
gttcacgcctttgccgatgaagttaaggaactggggcagtcactgccgcgctttaccgcg
cacacctggtatcgtcagccgagcgaagccgatcgcgctaaaggtcagtttgatagcgaa
ggtctgatggatttgagcaaactggaaggtgcgttcagcgatccgacaatgcagttctat
ctctgcggcccggttggcttcatgcagtttaccgcgaaacagttagtggatctgggcgtg
aagcaggaaaacattcattacgaatgctttggcccgcataaggtgctgtaa
              
                            

Download fasta file
RegulonDB