RegulonDB RegulonDB 10.8: Gene Sequence
hycA gene sequence


Size: 462        A: 133  T: 97  G: 116  C: 116

Fasta

 

>hycA E. coli K12. Version NC_000913.3 GI:556503834
atgactatttgggaaataagcgagaaagccgattacatcgcacagcggcatcgtcgccta
caggaccagtggcacatctactgcaattcgctggttcaggggatcacgttatcgaaagcg
cgcctgcatcacgccatgagctgcgcgccggacaaagaactctgtttcgtcctttttgaa
cattttcgcatttacgtcaccctggcggatggctttaacagccacaccatcgagtattac
gtcgaaacaaaagatggcgaagacaaacagcggattgcgcaggcgcaactgagcattgac
ggcatgattgatggcaaggtcaacatccgcgatcgcgaacaggttctggaacactatctc
gaaaaaatcgctggcgtttacgacagcttatacaccgctattgaaaacaatgtgccggtg
aatttaagccaactggtaaagggacaaagcccggcagcatga
              
                            

Download fasta file
RegulonDB