RegulonDB RegulonDB 10.8: Gene Sequence
hycB gene sequence


Size: 612        A: 127  T: 134  G: 172  C: 179

Fasta

 

>hycB E. coli K12. Version NC_000913.3 GI:556503834
gtgaatcgttttgtaattgctgactccacgctctgtatcggctgccacacttgtgaggcc
gcctgttcagagacgcatcgccagcacggcctgcaatcaatgccgcgcctgagagtgatg
ctgaatgaaaaagaatctgcgccgcagctctgtcaccactgtgaagatgcaccctgcgcg
gtggtctgcccggttaacgccatcacccgcgtcgatggggccgtgcagttgaatgaaagc
ctgtgcgtaagctgcaagctgtgcggcatcgcctgcccgtttggcgcaattgaattttcc
ggcagccgtccgctggatattccggcaaacgccaataccccgaaagcgccaccggcaccg
cctgctccggcgcgtgtcagcacattgcttgactgggtgccaggtattcgcgcgatcgcc
gtcaaatgtgacctttgtagctttgatgaacaaggtccggcctgcgtgcggatgtgcccg
actaaagccctgcatctggtggataacaccgatatcgcccgcgtcagcaaacgtaagcgt
gagctgacctttaacacggactttggcgatctcaccttgtttcagcaggctcaaagtgga
gaggctaaatga
              
                            

Download fasta file
RegulonDB