RegulonDB RegulonDB 10.8: Gene Sequence
hycC gene sequence


Size: 1827        A: 295  T: 469  G: 580  C: 483

Fasta

 

>hycC E. coli K12. Version NC_000913.3 GI:556503834
atgagcgcaatttccctgatcaatagcggcgtggcgtggtttgtcgccgccgctgttctg
gcatttctcttttcttttcaaaaagcgttaagtggctggatagctggaattggcggcgcg
gttggtagtctgtatacggcagccgcgggcttcactgtactgactggcgcggttggcgtg
agcggtgcgctgtcgctggtaagctacgatgtgcaaatctctccgcttaacgcgatttgg
ctgattacgctcggtctgtgcggtctgtttgtcagcctctacaacattgactggcatcgc
cacgcgcaggtgaagtgcaacggcttgcagatcaatatgttgatggctgccgccgtctgc
gccgtcattgccagcaacctcggcatgttcgtggtaatggccgaaatcatggccctgtgc
gcggtgttcctcaccagcaacagcaaagagggcaaactgtggtttgcgctggggcgtctt
ggcactctgctgctggcgattgcttgctggctgctgtggcagcgttacggcacgctggat
ctgcgcctgctggatatgcgtatgcaacagctgccgctcggttccgatatctggctgctc
ggagtgattggctttggcctgctggccgggattattccgctgcacggctgggtgccgcag
gcacatgcgaacgcctctgcgccagctgccgcgttgttttctacggtagtcatgaaaatt
ggcctgctgggcattttaaccctgtcactgctgggcggtaatgcaccgctgtggtggggg
atcgcgctgctggtgctcggcatgatcaccgcgtttgtcggtggtctgtatgcgctggtg
gagcacaacatccagcgcctgctggcttaccacaccctggaaaatatcggcatcatcctg
ctggggctgggcgctggcgtaacgggtatcgcgctcgaacaaccggcgctgattgctctt
ggcctggtcggtggtctgtaccatctgcttaaccatagcctgttcaaaagcgtactgttc
ctcggggcggggagcgtctggttccgtaccggtcatcgcgatatcgaaaaactcggtggt
attggcaagaaaatgccggttatctccatcgccatgttagtcgggctgatggcaatggct
gcgctgccgccgctgaatggttttgccggggaatgggttatctatcaatcatttttcaaa
ctgagcaatagtggcgcgtttgttgcccgtctgctggggccgctgctcgctgtggggctg
gcaattaccggtgcgctggcggtgatgtgtatggcgaaagtctatggcgtcacgttcctc
ggcgcgccgcgcaccaaagaagccgaaaacgccacctgtgcgccgctcctgatgagcgta
agcgtagtggcactggcgatttgctgcgtaattggcggtgttgctgcgccgtggctactg
ccgatgctctctgctgctgtacctctgccgctggagcctgctaacaccaccgtttctcaa
ccgatgatcacgttgctgctgattgcctgcccgctgctgccattcatcattatggcgatt
tgcaaaggcgatcgtttgccatcgcgttcccgcggtgcggcctgggtgtgcggttacgac
cacgaaaaatcaatggtgattaccgctcacggttttgccatgccggtgaaacaggcgttt
gcgccggtgctgaaactacgcaaatggctgaatccggtgtctctggtgccgggctggcag
tgcgaggggagtgcgttgctgttccgccggatggcgctggttgaactggcggtactggtg
gtgattattgtttcacgaggagcctga
              
                            

Download fasta file
RegulonDB