RegulonDB RegulonDB 10.8: Gene Sequence
hycD gene sequence


Size: 924        A: 140  T: 244  G: 286  C: 254

Fasta

 

>hycD E. coli K12. Version NC_000913.3 GI:556503834
atgagtgttttatatccgttaattcaggcgctggtgttatttgccgttgcgccgctgctc
tccggtataacccgcgtggcgcgcgcccgcttgcataaccgtcgcgggccgggcgtgttg
caggagtatcgcgacattatcaaactgctggggcgtcagagcgtcggcccggatgcctcc
ggctgggtgttccgcctgacgccgtatgtgatggtgggcgtcatgctgactatcgctact
gcgctgccggtggtgaccgtcggttctccgctgccgcaactgggtgatttgatcacctta
ctgtatctctttgccatcgcgcgtttcttctttgccatttctggtctggataccggtagc
ccgtttaccgctatcggcgcgagccgtgaagcgatgcttggcgtgctggtcgaaccgatg
ctgctgcttggtctgtgggttgccgcacaggttgccggttccaccaacatcagcaacatc
accgacaccgtttatcactggccgctgagccagagcatcccgctggtactggcgctttgt
gcctgtgcgttcgccacctttatcgaaatgggcaaactgccgttcgacctggcggaagcc
gagcaggagctgcaggaaggcccgctctctgaatacagcggcagcggctttggcgtcatg
aaatggggtatcagcctgaaacagctggtggtgttgcagatgttcgtcggggtgtttatt
ccgtggggacaaatggaaaccttcaccgccggtggactgctgctggcgctggtgattgcc
atcgtaaaactggtggtcggcgtcctggttatcgcgctgttcgaaaacagcatggcccgt
ctgcgtcttgatattactccgcgcattacctgggctgggtttggctttgcatttttagcg
ttcgtctccttgctggcggcgtga
              
                            

Download fasta file
RegulonDB