RegulonDB RegulonDB 10.8: Gene Sequence
hycE gene sequence


Size: 1710        A: 370  T: 367  G: 494  C: 479

Fasta

 

>hycE E. coli K12. Version NC_000913.3 GI:556503834
atgtctgaagaaaaattaggtcaacattatctcgccgcgctgaatgaggcatttccgggc
gtcgtgctggaccacgcctggcagaccaaagatcagctgactgtcaccgtaaaggtgaac
tacctgccggaagtggtggagtttctttactacaaacagggtggctggctgtcggtgctg
tttggtaacgacgaacgcaaactgaatggtcattacgccgtttactacgtgctgtcgatg
gagaagggcactaagtgttggattacggttcgcgtcgaagttgacgccaacaaaccggaa
tatccgtccgtgacgccgcgcgttccggcggcggtgtggggcgagcgtgaagtgcgcgat
atgtacggtttgattccggttggtctgccggatgaacgtcgtctggtgctgccggatgac
tggccggatgaactttatccgctgcgtaaagacagcatggattatcgtcagcgtccggca
ccgaccaccgatgctgaaacctacgagttcatcaacgaactgggcgacaagaaaaacaac
gtcgtgccgattggtccgctgcacgtcacttctgatgaaccgggccacttccgtctgttc
gtcgatggcgaaaacattatcgacgccgactaccgtctgttctacgtccatcgcggcatg
gaaaaactggcggaaacccgtatgggttataacgaagtgaccttcctctctgaccgtgtg
tgcgggatctgcggctttgcccacagcaccgcctacaccacgtcggtggaaaacgcgatg
ggtattcaggtgccagaacgtgcgcagatgatccgcgccattctgctggaggtagaacgc
ttgcactcgcatctgctcaaccttggcctggcctgtcactttaccggcttcgactccggc
tttatgcagttcttccgcgtgcgtgaaacctccatgaaaatggcagagatccttaccggt
gcgcgtaaaacctacggcctgaacttgatcggcgggattcgtcgcgatctgctgaaagac
gacatgatccagacccgccagctggcacaacagatgcgtcgtgaagtgcaggagctggtg
gatgtgctgctgagcactccgaacatggaacagcgcactgtcggcattggtcgtctggac
ccggaaatcgctcgcgacttcagtaacgtcggcccgatggtccgtgccagcggtcacgcc
cgtgatacccgcgccgatcacccgtttgtcggctatggcctgctgccaatggaagtccac
agcgagcagggctgcgacgttatttcccgtctgaaagtgcgtatcaacgaagtctatacc
gcgctgaacatgatcgactacggtctggataacctgccgggtggcccactgatggtggaa
ggctttacctacattccgcaccgctttgcgctgggctttgccgaagcgccgcgcggcgat
gatatccactggagcatgaccggcgacaaccagaagctgtaccgctggcgctgccgtgcc
gcgacctacgcgaactggccgaccctgcgctacatgctgcgcggcaacaccgtttccgat
gcgccgctgattatcggtagcctcgacccttgctactcctgtaccgaccgcatgaccgtg
gtcgatgtgcgtaagaagaagagcaaagtggtgccgtacaaagaactcgagcgttacagc
attgagcgtaaaaactcgccgctgaaataa
              
                            

Download fasta file
RegulonDB