RegulonDB RegulonDB 10.8: Gene Sequence
hycF gene sequence


Size: 543        A: 133  T: 108  G: 146  C: 156

Fasta

 

>hycF E. coli K12. Version NC_000913.3 GI:556503834
atgtttacctttatcaaaaaagtcatcaaaaccggcacggcgacctcgtcttatccgctg
gagccgattgcggttgataaaaacttccgtggtaagccagagcagaacccgcagcagtgc
atcggctgcgcggcctgcgtcaatgcctgcccgtcaaacgccttaacggttgaaactgac
ctcgccacaggagagcttgcctgggagtttaatcttgggcactgcatcttctgtggacgc
tgcgaagaagtctgcccgacggcggcgatcaaactgtcgcaagagtacgaactggcggtg
tggaagaaagaagacttcctgcaacagtcccgcttcgcgctgtgcaactgccgcgtctgc
aatcgtcctttcgccgtccagaaagagatcgactacgccattgcgctgcttaagcacaac
ggcgacagccgcgcggaaaaccaccgcgaaagctttgagacttgcccggaatgtaagcgc
cagaaatgcctggtgccgtccgaccgtattgaactgactcgccatatgaaagaggccatc
tga
              
                            

Download fasta file
RegulonDB