RegulonDB RegulonDB 10.8: Gene Sequence
hycH gene sequence


Size: 411        A: 105  T: 89  G: 123  C: 94

Fasta

 

>hycH E. coli K12. Version NC_000913.3 GI:556503834
atgagtgaaaaggtggtgttcagtcaactgagccgtaaatttattgatgagaacgatgcc
acgcccgccgaggcgcagcaggtggtctattacagcctggcgattggtcaccaccttggg
gttatcgattgcctggaagcggcgctcacctgcccgtgggatgaatatctggcatggatt
gccactctggaggcaggcagtgaagcccgccgcaaaatggaaggcgtgccgaaatatggt
gagatcgtcatcgacattaaccatgtgccgatgctggccaacgcattcgataaagcccgg
gcagcgcaaacttcgcagcagcaggaatggagtacaatgctgttaagtatgctgcatgat
attcatcaggaaaacgccatctatttgatggtgaggagactgcgtgactga
              
                            

Download fasta file
RegulonDB