RegulonDB RegulonDB 10.10: Gene Sequence
zraR gene sequence


Size: 1326        A: 300  T: 280  G: 419  C: 327

Fasta

 

>zraR E. coli K12. Version NC_000913.3 GI:556503834
atgacgcacgataatatcgatattctggtggtggatgatgacattagccactgcactatt
ttgcaggctttactgcgcggctggggctataacgtcgcgctggcgaacagcgggcgacag
gcgttggagcaggtgcgggaacaggtttttgatcttgtgctttgcgatgtgcgaatggcg
gagatggacggcatcgccacgctgaaagagatcaaagcgttaaacccggcaattccggtg
ctgattatgactgcgtactccagcgtcgagacggcggtagaggcactgaaaactggggcg
ctggattatctcatcaagccgctggatttcgataacctacaggcgacgctggaaaaagcg
ctcgcgcatacgcacagtattgatgctgaaacacctgcggtgactgccagccagttcggt
atggtcggtaaaagcccggcgatgcaacacctgctcagtgaaatcgccctcgtcgcgcca
tcggaagccacggtactgatccacggcgattccggcaccggtaaagagctggtcgccagg
gcgattcacgccagtagcgcacgtagcgaaaaaccgctggtaacgctcaactgtgcggca
ctcaacgaatccttgctggaatctgaattgttcggtcacgaaaaaggggcgtttactgga
gccgataaacgccgggaagggcgctttgttgaggcggacggcggcacgctgtttctcgat
gaaattggcgatatctcgccgatgatgcaggtgcgtctgctgcgtgcgattcaggagcgc
gaagttcagcgtgtcggtagcaaccagattatctcggttgatgtccggctgattgcggcg
acccatcgcgatcttgccgcagaggtgaatgccgggcgttttcgccaggatctctactat
cgcctgaatgtggtggcgattgaagtaccatcgctgcggcaacggcgggaagatatccct
ctgctggctggccattttctgcagcgctttgccgagcgtaatcgcaaggcggtaaaaggt
tttacgccccaggcgatggatctgttgattcattacgactggccgggaaatattcgtgag
ctggaaaacgcggtggaacgggcagtggtgctgctgaccggggaatatatttccgaacgc
gagctgccgctggcgattgccagtacgccgatcccgctgggacaaagtcaggatattcag
ccgttggtggaagtggaaaaagaggtgattctggcggcgctggagaaaacgggcggcaac
aaaaccgaagccgcccgtcagttagggatcacgcgcaaaacgctattggcaaaactgtcg
cgttag
              
                            

Download fasta file
RegulonDB