RegulonDB RegulonDB 10.8: Gene Sequence
hypB gene sequence


Size: 873        A: 218  T: 173  G: 231  C: 251

Fasta

 

>hypB E. coli K12. Version NC_000913.3 GI:556503834
atgtgtacaacatgcggttgcggtgaaggcaacctgtatatcgagggtgatgaacataac
cctcattccgcgtttcgtagcgcgccatttgccccggcggcacgcccgaagatgaaaatc
accggcattaaagcgcctgaatttacccccagccagactgaagaaggcgacctgcattac
ggtcatggcgaagcgggcactcacgcaccgggcatgagccagcgtcggatgctggaagtc
gaaattgacgtgctggacaaaaataaccgtctggctgaacgcaaccgcgcgcgctttgct
gcccgcaagcaactggtgctcaacctggtttccagccctggttccggtaaaaccaccctg
ctgacggaaaccctaatgcgcctgaaagacagcgttccgtgcgcagttattgaaggcgac
cagcaaaccgtgaacgatgccgcacgcattcgcgctaccggcacaccagcgattcaggtg
aacaccggtaaaggctgccatcttgacgcacagatgattgccgacgccgcaccgcgtctg
ccactggacgataacggtattctgtttatcgaaaacgttggcaacctcgtatgcccggcc
agcttcgatctcggtgaaaaacacaaagtggcggtgctttccgttaccgaaggtgaagac
aaaccactgaaatatccgcatatgtttgccgccgcctcgctgatgctgctcaacaaagtt
gacctgttgccgtatctcaactttgacgttgaaaagtgcatcgcctgcgcccgcgaagtc
aatccagaaattgaaatcatccttatttccgccaccagcggcgaagggatggaccagtgg
ctgaactggctggagacacagcgatgtgcatag
              
                            

Download fasta file
RegulonDB