RegulonDB RegulonDB 10.8: Gene Sequence
hypC gene sequence


Size: 273        A: 65  T: 57  G: 83  C: 68

Fasta

 

>hypC E. coli K12. Version NC_000913.3 GI:556503834
atgtgcataggcgttcccggccagatccgcaccattgacggcaaccaggcgaaagtcgac
gtctgcggcattcagcgcgatgtcgatttaacgttagtcggcagctgcgatgaaaacggt
cagccgcgcgtgggccagtgggtactggtacacgttggctttgccatgagcgtaattaat
gaagccgaagcacgcgacactctcgacgccttacaaaacatgtttgacgttgagccggat
gtcggcgcgctgttgtatggcgaggaaaaataa
              
                            

Download fasta file
RegulonDB