RegulonDB RegulonDB 10.8: Gene Sequence
hypD gene sequence


Size: 1122        A: 234  T: 266  G: 326  C: 296

Fasta

 

>hypD E. coli K12. Version NC_000913.3 GI:556503834
atgcgttttgttgatgaatatcgcgcgccggaacaggtgatgcagttaattgagcatctg
cgcgaacgtgcttcacatctctcttacaccgccgaacgccctctgcggattatggaagtg
tgtggcggtcatacccacgctatctttaaattcggcctcgaccagttactgccggaaaac
gttgagtttatccacggtccggggtgcccggtgtgcgtactgccgatgggtagaatcgac
acctgcgtggagattgccagccatccggaagtcatcttctgtacctttggcgacgccatg
cgcgtgccggggaaacagggatcgctgttgcaggcaaaagcacgcggtgccgatgtgcgc
atcgtttactcgccgatggatgcgttgaaactggcgcaggagaatccaacccgcaaagtg
gtgttcttcggcttaggttttgaaaccactatgccgaccaccgctatcactctgcaacag
gcgaaagcgcgtgatgtgcagaatttttacttcttctgccagcacattacgcttatcccg
acgttgcgcagtttgctggaacagccggataacggtatcgatgcgttcctcgcgccgggt
cacgtcagtatggttatcggcaccgacgcctataattttatcgccagcgattttcatcgt
ccgctggtggttgctggattcgaaccccttgatctactacaaggcgtggtcatgctggtg
cagcagaaaatagcggcccacagcaaggtagagaatcagtatcgtcgagtggtaccggat
gccggtaacctgctggcgcaacaggcgattgccgatgtgttctgtgtcaacggcgacagc
gaatggcgcggcttaggcgtgattgaatcttctggcgtgcacctgacgccggattatcaa
cgattcgatgccgaagcacatttccgcccggcaccgcagcaggtctgcgatgacccgcgc
gcgcgttgtggtgaggtattaacgggcaaatgtaagccgcatcaatgcccgctgtttggt
aacacctgtaatcctcaaaccgcgtttggtgcgctgatggtttcctccgaaggagcgtgc
gccgcgtggtatcagtatcgtcagcaggagagtgaagcgtga
              
                            

Download fasta file
RegulonDB