RegulonDB RegulonDB 10.8: Gene Sequence
hypE gene sequence


Size: 1011        A: 214  T: 218  G: 312  C: 267

Fasta

 

>hypE E. coli K12. Version NC_000913.3 GI:556503834
gtgaataatatccaactcgcccacggtagcggcggccaggcgatgcagcaattaatcaac
agcctgtttatggaagcctttgccaacccgtggctggcagagcaggaagatcaggcacgt
cttgatctggcgcagctggtagcggaaggcgaccgtctggcgttctccaccgacagttac
gttattgacccgctgttcttccctggcggtaatatcggcaagctggcgatttgcggcaca
gccaatgacgttgcggtcagtggcgctattccgcgctatctctcctgtggctttatcctc
gaagaaggattgccgatggagacactgaaagccgtagtgaccagcatggcagaaaccgcc
cgcgcggcaggcattgccatcgttactggcgatactaaagtggtgcagcgcggcgcggta
gataaactgtttatcaacaccgctggcatgggcgcaattccggcgaatattcactggggc
gcacagacgctaaccgcaggcgatgtattgctggtgagcggtacactcggcgaccacggg
gcgactatccttaacctgcgtgagcagctggggctggatggcgaactggtcagcgactgc
gcggtgctgacgccgcttattcagacgctgcgtgacattcccggcgtgaaagcgctgcgt
gatgccacccgtggtggtgtaaacgcggtggttcatgagttcgcggcagcctgcggttgt
ggtattgaactttcagaagcggcactgcctgttaaacctgccgtgcgtggcgtttgcgaa
ttgctgggactggacgccctgaactttgccaacgaaggcaaactagtaatagctgttgaa
cgcaacgcggcagagcaagtgctggcagcgttacattcccatccactggggaaagacgcg
gcgctgattggtgaagtggtggaacgtaaaggtgttcgtcttgccggtctgtatggcgtg
aaacgaaccctcgatttaccacacgccgaaccgcttccgcgtatatgctaa
              
                            

Download fasta file
RegulonDB